Suggested problems

Robinhood customer service team-avail of solution service at once:

Aug. 25, 2021, 11:56 a.m. by Kingmark

Biological Motivation

Many Robinhood customers are there who go through tech problems while trading online. But all those can be resolved with the help of the [Robinhood customer service][https://www.contactsupport-number.net/phone-number/robinhood/] team. They are experts at recognizing real-time solutions and provide them with a platform that may help them effectively. Robinhood customers are the most legitimate sources of solution for appropriate management of online trading platforms like Robinhood. ...

[1]: https://www.contactsupport-number.net/phone-number/robinhood/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21