Suggested problems

Can the sender cancel a Cash App payment when required?

Aug. 25, 2021, 11:54 a.m. by Kingmark

Biological Motivation

In the wake of the tech issues, cash app users are frequently trying to understand the method for the cancellation of the payment. This is why they search for [Can the sender cancels a Cash App payment][1]. Cancellation can be done with specific tips. All customers are not familiar with the process and hence they can contact the cash app support team for instant assistance to keep managing the needs that arise.

[1]: https://www.emailsupport-contact.com/blog/can-you-cancel-a-pending-cash-app-transaction

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21