Suggested problems

à fournir la plus belle copie papier de votre mariage à chérir

Aug. 25, 2021, 2:10 a.m. by goodrobe.fr

Biological Motivation

Un conseil pour les couples qui planifient leur mariage maintenant ? Conseils de la mariée: Lorsque vous planifiez un mariage de bricolage avec un budget limité, vous pouvez bien sûr rechercher des talents via des amis ou des connaissances, ou faire appel à des vendeurs qui débutent. Mon plus grand conseil est de s'assurer qu'il y a de la paperasse pour tous les services rendus, des devis aux accords en passant par les factures robe longue de cérémonie, de tous les fournisseurs, même s'ils ne sont « qu'un ami d'un ami ». Les poignées de main (même numériques) ne suffisent pas ! Aussi, j'exhorte les couples à ne pas lésiner sur la photographie.

https://www.goodrobe.fr

Les photos sont la documentation de tout votre travail acharné et la meilleure référence visuelle pour les souvenirs que vous aurez pour le reste de votre vie. Un grand photographe fait toute la différence (de la flexibilité lorsque l'emploi du temps se déroule (ce qu'il fera) à être agréable avec vous et votre famille et vos invités, à fournir la plus belle copie papier de votre mariage à chérir).Conseil du marié : Choisissez vos batailles. Dites oui à tout dans la limite du raisonnable. Ne perdez pas de vue le fait que vous et votre partenaire êtes les meilleurs amis, car les choses vont mal se passer quoi qu'il arrive, mais vous êtes le meilleur et le plus précieux système de soutien l'un de l'autre.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21