Suggested problems

Why is an eCommerce Website important for your Business!

Aug. 24, 2021, 9:17 a.m. by KitoInfocom

Biological Motivation

Regardless of the kind of business you possess, an [Ecommerce website design company][1] will use its best abilities to focus on the core activities of your company. Consumers have moved to the Internet that meets their demands because they can order anything they want from the comfort of their own offices or homes. Such eCommerce web designers make your website look good, be easy to use, and be fully functional. However, the advantages have yet to be discovered! Now let’s took a glance at a couple of them.

[1]: https://www.kitoinfocom.com/services/ecommerce-website-development-company.php

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21