Suggested problems

vidalista 20

Aug. 20, 2021, 7:05 a.m. by Tadarise 20 mg

Biological Motivation

[vidalista 10][1] mg is a treatment for guys with impotence. This is when a man can not get, or keep a tough, erect penis suitable for sexual activity.

[vidalista 20][2] mg is the best solution for erectile dysfunction in men. Are you searching for the best solution for impotency? Search nowhere else. Buy Vidalista 20 mg, and use it to enjoy intense sex whenever you are sexually stimulated. ED is a common sexual problem and millions of men have started to buy Vidalista 20 mg online and have realized the difference it can bring into their sex life. ED is not very serious, as there are several effective treatment options available for it, including Vidalista in many dosages.

Generic [vidalista 40][3] mg is the best solution for erectile dysfunction in men. Are you searching for the best solution for impotency? Search nowhere else. Buy Vidalista 40 mg, and use to enjoy intense sex whenever you are sexually stimulated. ED is a common sexual problem and millions of men have started to buy Vidalista 40 mg online and have realized the difference it can bring into their sex life. ED is not very serious, as there are several effective treatment options available for it, including Vidalista in many dosages.

Buy [vidalista 60][4] Mg Online, It Includes An Energetic Component Tadalafil, Which Is An FDA-Approved Medicine Used To Treat Erectile Dysfunction Problems In Guy. It’s The Only Medication Proven To Treat ED Issues For As Long As 36 Hours.

[vidalista 80][5] mg is used as needed, you are not most likely to be on an application schedule. If you take it every day and also miss a dosage, take the missed dose as soon as you bear it in mind. Skip the missed dosage if it is virtually time for your following scheduled dosage. Do not take additional medicine to make up for the missed dose.

[vidalista black][6] is used as needed, you are not most likely to be on an application schedule. If you take it every day and also miss a dosage, take the missed dose as soon as you bear it in mind. Skip the missed dosage if it is virtually time for your following scheduled dosage. Do not take additional medicine to make up for the missed dose.

[super vidalista][7] is a medicine utilized to deal with impotence and also early orgasm in males. Erectile dysfunction and early ejaculation are two efficiency issues that impact sexual satisfaction.

[vidalista professional][8] is a treatment for guys with erectile dysfunction. This is when a male can not get, or keep a hard, set-up penis suitable for sexual activity.

[1]: https://www.mymedistore.com/product/vidalista-10-mg/ [2]: https://www.mymedistore.com/product/vidalista-20-mg/ [3]: https://www.mymedistore.com/product/vidalista-40-mg/ [4]: https://www.mymedistore.com/product/vidalista-60-mg/ [5]: https://www.mymedistore.com/product/vidalista-black-80-mg/ [6]: https://www.mymedistore.com/product/vidalista-black-80-mg/ [7]: https://www.mymedistore.com/product/super-vidalista/ [8]: https://www.mymedistore.com/product/vidalista-professional-pills/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21