Suggested problems

The IT Institute in India

April 30, 2019, 9:52 a.m. by mounika123

Biological Motivation

onlineITguru is the globally professional institute for IT courses and training. This emphasizes hands-on experience with examples from real-time scenarios by experts.It is conceptualized and initiated by several multidisciplinary and ingenious software technocrats having the combined experience of more than 10+ yrs in the industry. Learn the best IT technologies [Tableau online Training][1]

Online IT Guru Offer corporate Training toward trending technologies includes a basic role with training provides the knowledge and skills to the student. This training is mainly focused on knowledge instructions with an online education with particular concepts and the student can apply to a specific real-time work.

Our institute provides best online sessions with well-skilled experts through them improve our ability for assist our resources.

Our trainer has excellent knowledge with Real time Experience in projects. Live online training makes you regular studying and unique ability for online training and classify over the work and help.

Benefits of OnlineITGuru Free Demo Lifetime Access to all Training videos Low fee 24x7 Guidance & Support Training by Industry experts Real-Time Projects Resume Preparation Interview Preparation Real-Time Job Support

[1]: https://onlineitguru.com/tableau-online-training-placement.html

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21