Suggested problems

mais restez fidèle à vous-même et cela se verra le jour de votre mariage

Aug. 18, 2021, 3:05 a.m. by goodrobe.fr

Biological Motivation

Un conseil pour les couples qui planifient leur mariage maintenant ? Même si la plupart de la planification et des décisions semblent être prises par la mariée, tenez compte des (probablement très peu) choses qui sont importantes pour votre futur mari. Brian m'a laissé m'occuper du décor, des couleurs et de tous les détails « girly », mais il voulait choisir les sélections de bars et la chanson à laquelle nous avons été présentés location robe mariee paris, « Baba O'Riley » de The Who.

https://www.goodrobe.fr/robe-de-mariee-e12

L'excitation qu'il a ressentie et montrée lorsque nous avons découvert cette chanson a rayonné dans toute la salle et a vraiment fait vibrer la foule ! Il est facile de se laisser entraîner dans les moindres détails de la planification – car il y a BEAUCOUP DE DÉTAILS – mais gardez à l'esprit que le mariage est une célébration de l'amour que vous partagez tous les deux robe demoiselle d honneur 12 ans, et donc la célébration doit vous refléter tous les deux. Tout le monde aura une opinion sur ce qu'il faut faire ou ne pas faire, mais restez fidèle à vous-même et cela se verra le jour de votre mariage.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21