Suggested problems

How Hard It Is To Unlock Cash App Account If A New User?

Aug. 13, 2021, 1:20 p.m. by stuardboard

Biological Motivation

Finding out the proper information on how to [Unlock Cash App Account][1] is not a big deal.The best mode of unlocking your Cash App account without any kind of hassle, you need to get in touch with the right aid under the proper supervision of the Cash App specialists who will help you out in every possible manner.

[1]: https://www.myaccountrecovery.com/blog/be-acquainted-with-the-relevant-procedure-to-unlock-cash-app-account/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21