Suggested problems

Crucial factors of Cash app customer service features:

Aug. 13, 2021, 1:19 p.m. by stuardboard

Biological Motivation

It is by and large huge for [Cash app customer service][1] to consider the solution variables of the cash app account. The changing time has made the necessity for an online stage that may work viably and without getting influenced by particular issues. Regardless, it's everything except a possible factor, and in addition to these mentioning, the assistance by a qualified support team can remove all issues at once.

[1]: https://www.mailsupportnumber.com/cash-app-customer-service-number.html

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21