Suggested problems

How to utilize the facility of Cash app customer service?

Aug. 13, 2021, 1:18 p.m. by stuardboard

Biological Motivation

The trend of online payment has become a core aspect in the current time. The clarification is that it can quickly send money with few clicks and can be utilized anytime. It is obligatory to comprehend the meaning of Cash application client support. Selecting the tactics that may help cash app users will allow them to utilize the facilities of the [Cash app customer service][1] as per the convenience.

[1]: https://www.emailcontacthelp.com/cash-app-customer-service.html

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21