Suggested problems

Best Astrologer in chennai online

Aug. 13, 2021, 12:25 p.m. by Alka Ajith

Biological Motivation

Are you confused about your future? Life is messed up with worries and stress? Online horoscope matching is a definite solution.Our Expert Astrologer at Astro Thoughts, one of the best astrologer in Tamilnadu will guide you in all your concerns regarding, marriage, money, time, health,career, family and any critical life decision. His services extend with jathagam porutham in tamil online,thirumana porutham online,jathaka porutham by date of birth,rasi porutham online,online kundli matching,peyar porutham in tamil,rasi natchathiram porutham and many more. Your search for the best astrologer near me ends with Chat with our Astro Thoughts Astrologer.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21