Suggested problems

Seek out impact of cash app customer service team:

Aug. 11, 2021, 10:05 a.m. by stuardboard

Biological Motivation

The impact of the cash app customer service team needs to be understood by the cash app customers. The utilization of the cash app has taken a core space for transactional activities online. Therefore, cash app customers should be familiar with the possible flaws and try to keep in touch with the [cash app customer service][1] team. They are work with a complete strategy to sort out the issues that face with their cash app account from time to time.

[1]: https://www.primotechy.com/cash-app-customer-service-phone-number/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21