Suggested problems

Working strategy of cash app customer service team:

Aug. 11, 2021, 10:04 a.m. by stuardboard

Biological Motivation

The strategic system should be applied when it comes to managing the cash app account. The increasing number of troubles has led to unexpected scenarios. Thus, if cash app customers talk to the [cash app customer service][1] team, then they can get rid of the problems immediately. The reason is service professionals work suing their expertise and allow cash app users to avail of perks offered by cash app.

[1]: https://www.emailcontacthelp.com/cash-app-customer-service.html

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21