Suggested problems

Attributes of cash app customer service team:

Aug. 11, 2021, 10:03 a.m. by stuardboard

Biological Motivation

The changing time has created lots of issues for cash app users. Transactional terms are based on the cash app account. But several times, people could not cope up with the technical glitches they face. In such a situation, cash app users may talk to the [cash app customer service][1] team. Glitches worsen the situation gradually and cash app customers could not send and receive the money at last.

[1]: https://www.contactsupport-number.net/cash-app-customer-service-number/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21