Suggested problems

how to take care of sphynx kittens

Aug. 10, 2021, 7:38 p.m. by janetlopez

Biological Motivation

Because of their lack of fur, sphynx cats have incredibly oily and sweaty skin. ¹ This means this breed needs weekly baths to maintain healthy and clean skin. Use warm, not hot, water and a medicated pet shampoo without a powerful scent to bath them. For further information please visit our website below:

http://sphynxs4homes.company.com

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21