Suggested problems

sphynx kittens for sale

Aug. 10, 2021, 8:19 a.m. by janetlopez

Biological Motivation

We have absolutely stunning litter of girls and boys of pure beauty Sphynx kittens. They are perfectly content curled up on your lap! More than just cats, they are members of the family and whilst they exude grace and sophistication, they are outgoing, sociable and playful. Kittens are registered with TICA. Have microchip, have been worm&flea treated , have 1st vaccination. Kittens are ready to go to the new family. Visit our website below:

http://sphynxs4homes.company.com

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: We have absolutely stunning litter of girls and boys of pure beauty Sphynx kittens. They are perfectly content curled up on your lap! More than just cats, they are members of the family and whilst they exude grace and sophistication, they are outgoing, sociable and playful. Kittens are registered with TICA. Have microchip, have been worm&flea treated , have 1st vaccination. Kittens are ready to go to the new family. Visit our website below:

http://sphynxs4homes.company.com

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21