Suggested problems

Oracle SOA Online Certification Training

Aug. 7, 2021, 5:24 a.m. by Zaid md

Biological Motivation

This Oracle SOA is suitable for training developers, managers, or architects who want to gain a solid foundation and expertise in Oracle Suite 12C solutions. This course covers BPL Modeling, Business Rules, Adapters, Event Processing, Security Services, Business Activity Monitoring, Troubleshooting, Installation, Configuration, Deployment, and more. This certification course provides the knowledge needed to provide competitiveness through proven expertise.

Key Features 30 Hrs Live Training 10 hrs Lab Sessions Certification Assistance Career Assistance Flexible Schedule 24/7 Lifetime Support

To schedule and attend the free demo click here [Oracle SOA Online Certification Training][1]

About MindMajix MindMajix is a live and interactive e-learning platform that offers professional online education to help companies improve their profitability drastically. Our courses are perfectly designed for individuals seeking further professional recognition and independent certification to enhance their course outcomes and qualities.

Contact Us India: +91 924 633 3245 USA: +1 917 456 8403 info@mindmajix.com

[1]: https://mindmajix.com/oracle-soa-training

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21