Suggested problems

Will Cash App Refund Money If Scammed erratically?

Aug. 5, 2021, 9:22 a.m. by harryporter

Biological Motivation

An unexpected situation like scamming on the cash app may lead to the disturbance to the mind of cash pp users. In many cases, they are asking [Will Cash App Refund Money If Scammed][1]. What may be the reason behind such a situation is the matter. But instated of getting worried, cash app users should think of asking for help from the cash app service team. They work honestly to sort out their customer’s concerns.

[1]: https://www.contactmail-support.com/blog/will-cash-app-refund-money-if-scammed/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21