Suggested problems

How to generate new Roku Activation Code?

April 8, 2019, 10:10 a.m. by BenOrton

Biological Motivation

Device activation is successful only with a correct link code. Therefore, when you either lose the activation code or if it has expired, you may face the necessity to create a new code. In such circumstances, using your remote generate a new activation code. Just choose the STAR button on the remote followed by the Create a new code option. This will fetch you a new [Roku Activation Code][1] for completing the Roku device activation. Remember that this code is both case sensitive and also may expire within a certain period of time. For more details Ring the contact number @ +1-844-360-7450.

[1]: https://www.rokuactivationcode.net

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21