Suggested problems

Giới thiệu dự án Hải Giang Merry Land

Aug. 3, 2021, 11:40 p.m. by Hải Giang Merry Land

Biological Motivation

[b]Hải Giang Merry Land[/b] Quy Nhơn là dự án khu đô thị ven biển Hải Giang rộng 650 ha, tọa lạc tại vùng kinh tế Nhơn Hội, thành phố Quy Nhơn, tỉnh Bình Định. Đây là dự án mang thương hiệu quốc tế đầu tư tại vùng biển Quy Nhơn xinh đẹp với đường bờ biển dài 134km, đây được xem là dự án tiên phong đưa bất động sản nghĩ dưỡng hạng sang vào phát triển miền đất võ nổi tiếng.

[b]Hải Giang Merry Land [/b]Quy Nhơn có quy mô gồm 300 phòng khách sạn 5 sao, biệt thự nghỉ dưỡng và chuỗi tiện ích dịch vụ siêu sang như sân golf 18 lỗ hứa hẹn đem đến một không gian nghỉ dưỡng tinh tế, đích thực để mỗi khoảnh khắc tại đây đều tạo ra nguồn cảm ứng và sức sống mới. Sở hữu vị trí vàng “tựa sơn, hướng thủy”, tựa vào núi Phương Mai hướng mặt biển Hải Giang chắc chắn đem đến tài lộc, thịnh vượng cho gia chủ sở hữu hơn nữa, tiềm năng gia tăng giá trị của Biệt thự MerryLand Quy Nhơn được bảo chứng chắc chắn. Dịch vụ Quản lý & Vận hành đạt chuẩn 5 sao quốc tế cùng hệ thống ứng dụng công nghệ thông minh được khai thác hoàn hảo của MerryLand Quy Nhơn. Nơi giới tinh hoa chinh phục những giá trị hoàn mỹ từ cảnh quan – thắng cảnh nức tiếng nơi miền đất VÕ – Bình Định. [b] Liên hệ với Hải Giang Merry Land[/b] - Địa chỉ: Hải Giang, Tp. Qui Nhơn, Bình Định 55122, Việt Nam - Số điện thoại: 0913703757 - Website: https://haigiangmerrylands.vn/

haigiangmerryland #merryland #hungthinh

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21