Suggested problems

Giới thiệu dự án Hải Giang Merry Land

Aug. 3, 2021, 11:39 p.m. by Hải Giang Merry Land

Biological Motivation

[b]Hải Giang Merry Land[/b] Quy Nhơn là dự án khu đô thị ven biển Hải Giang rộng 650 ha, tọa lạc tại vùng kinh tế Nhơn Hội, thành phố Quy Nhơn, tỉnh Bình Định. Đây là dự án mang thương hiệu quốc tế đầu tư tại vùng biển Quy Nhơn xinh đẹp với đường bờ biển dài 134km, đây được xem là dự án tiên phong đưa bất động sản nghĩ dưỡng hạng sang vào phát triển miền đất võ nổi tiếng.

[b]Hải Giang Merry Land [/b]Quy Nhơn có quy mô gồm 300 phòng khách sạn 5 sao, biệt thự nghỉ dưỡng và chuỗi tiện ích dịch vụ siêu sang như sân golf 18 lỗ hứa hẹn đem đến một không gian nghỉ dưỡng tinh tế, đích thực để mỗi khoảnh khắc tại đây đều tạo ra nguồn cảm ứng và sức sống mới. Sở hữu vị trí vàng “tựa sơn, hướng thủy”, tựa vào núi Phương Mai hướng mặt biển Hải Giang chắc chắn đem đến tài lộc, thịnh vượng cho gia chủ sở hữu hơn nữa, tiềm năng gia tăng giá trị của Biệt thự MerryLand Quy Nhơn được bảo chứng chắc chắn. [img]https://1.bp.blogspot.com/-dfLL00ieUyQ/YQnJ6SfFpSI/AAAAAAAAANo/3qVQCJ1nh3gdCBR0OPE73VukcgqBGE2BgCLcBGAsYHQ/w640-h362/hai-giang-merry-land-2-1-800x452.jpg[/img] [b]TỔNG QUAN DỰ ÁN HẢI GIANG MERRY LAND QUY NHƠN[/b] Tên dự án: Hải Giang Merry Land Vị trí: Thôn Hải Giang, xã Nhơn Hải, TP Quy Nhơn, tỉnh Bình Định Chủ đầu tư: Tập đoàn Hưng Thịnh Tổng diện tích: 656 ha (305 hecta sẽ được cải tạo trồng rừng để phát triển sinh thái) Số vốn đầu tư: 3.500 tỷ đồng Quy mô dự án: 300 phòng khách sạn 5 sao, đất nền biệt thự nghỉ dưỡng và khu vui chơi giải trí.. Hệ thống cáp treo nối liền Mũi Tấn với bán đảo Phương Mai Khu công viên cây xanh Sân Golf với 18 lỗ Diện tích đất nền: 108 – 300 m2 Các loại Villas: 240 m2, 300m2,… Cầu nối từ Khu kinh tế Nhơn Hội đến Khu du lịch Hải Giang Merry Land Xét đề nghị của Ban Quản lý Khu kinh tế tại Văn bản số 1150/BQLQLQHXD ngày 04/10/2013 về việc đầu tư Cầu nối từ đường trục Khu kinh tế Nhơn Hội đến Khu du lịch Hải Giang Merry Land. Chủ tịch UBND tỉnh Bình Định có ý kiến như sau:

Thống nhất với đề xuất của Ban Quản lý Khu kinh tế tại Văn bản nêu trên đối với việc Nhà đầu tư tự bỏ kinh phí đầu tư xây dựng Cầu nối từ đường trục Khu kinh tế Nhơn Hội đến Khu du lịch Hải Giang Merry Land Quy Nhơn (đoạn đi ngang qua Vịnh Mai Hương). Giao Ban Quản lý Khu kinh tế hướng dẫn nhà đầu tư lập dự án đầu tư, phương án thiết kế, báo cáo UBND tỉnh trong tháng 11/2019. [img]https://1.bp.blogspot.com/-DAUbj7VSU9k/YQnJXfncI9I/AAAAAAAAANc/DifaoSO8nBkjYzWgta0YNOE2IjbX5-X-QCLcBGAsYHQ/w586-h640/van-ban-xay-cau-noi-nhon-hoi-voi-hai-giang-merry-land.jpg.webp[/img] [b]Tiện ích Hải Giang Merry Land:[/b] [b]Dự án Hải Giang Merry Land [/b]mang thương hiệu quốc tế do Tập đoàn Hưng Thịnh Corp đầu tư tại vùng biển Quy Nhơn xinh đẹp với đường bờ biển dài 134 km, dự án được đánh giá là phát súng tiên phong đưa các dự án bất động sản đến gần hơn với vùng đất Quy Nhơn nổi tiếng. Đồng thời tận dụng những ưu thế sẵn có mà vùng đất này ban tặng để đem lại những tiện ích đẳng cấp phục vụ nhu cầu của cư dân.

Dịch vụ Quản lý & Vận hành đạt chuẩn 5 sao quốc tế cùng hệ thống ứng dụng công nghệ thông minh được khai thác hoàn hảo của MerryLand Quy Nhơn. Nơi giới tinh hoa chinh phục những giá trị hoàn mỹ từ cảnh quan – thắng cảnh nức tiếng nơi miền đất VÕ – Bình Định. [img]https://1.bp.blogspot.com/-aPm_gktwkCE/YQnJ6eExdtI/AAAAAAAAANs/3sfnnaM6W9Ye5mNmQPdR9oqFad-z22a4wCLcBGAsYHQ/w640-h360/hai-giang-merry-land-3-1-800x451.jpg[/img] [b]Tiện ích nội khu nổi bật tại Hai Giang Merry Land cần được kể đến như :[/b]

Hệ thống phòng tập gym hiện đại giúp mọi người rèn luyện sức khỏe Sân tennis rộng rãi với dịch vụ phục vụ tốt nhất khiến cho khách hàng có những giây phút thư giãn nhất Sân golf với mặt bằng rộng rãi Khu vui chơi giải trí dành cho tất cả mọi người, đặc biệt là trẻ em, hoàn toàn an toàn và rất đa dạng Khu y tế với đội ngũ nhân viên tận tình, có chuyên môn cao Khách sạn 5 sao Trường học gần kề Hồ cảnh quang với các lối đi bộ được xây xung quanh rất thích hợp để tản bộ mỗi buổi chiều Quảng trường hạnh phúc với thiết kế lung linh, huyền ảo, thích hợp cho những hoạt động cộng đồng Với bãi biển dài tự nhiên, bãi cát trắng, nước xanh trắng vàng, cư dân và du khách sinh sống tại KĐT Hải Giang Merry Land sẽ được sống chan hòa với thiên nhiên biển cả, hít thở không khí trong lành. Chọn vùng biển Quy Nhơn xinh đẹp làm vị trí cho dự án, chủ đầu tư đã rất cố gắng tận dụng những ưu thế lớn nhất để đem lại những dịch vụ tiện ích một cách cao cấp nhất.

Song,quan trọng hơn cả là mong muốn xây dựng một không gian sống tự nhiên, gần gũi với thiên nhiên để đem lại cảm giác thanh bình, yên ả nhất cho cư dân, điều đó đặc biệt có ý nghĩa trong xã hội hiện đại ngày nay, con người dễ bị áp lực bởi công việc và cần được nghỉ ngơi đúng nghĩa.

[b] Liên hệ với Hải Giang Merry Land[/b] - Địa chỉ: Hải Giang, Tp. Qui Nhơn, Bình Định 55122, Việt Nam - Số điện thoại: 0913703757 - Website: https://haigiangmerrylands.vn/

haigiangmerryland #merryland #hungthinh

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21