Suggested problems

Black Magic

Aug. 3, 2021, 6:14 a.m. by Black Magic Specialist Astrologer

Biological Motivation

There are so many ways to solve human problems that they face many issues, but black magic Specialist astrologer are very effective for technology to destroy human suffering. Our Black Magic Expert is popular and used more in countries around the world. call (+91-9872114288)

http://www.vashikaranspells.com/online-black-magic-specialist-astrologer.php

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21