Suggested problems

essayez d'organiser un événement décontracté le lendemain du mariage

Aug. 3, 2021, 1:48 a.m. by goodrobe.fr

Biological Motivation

Un conseil pour les couples qui planifient leur mariage maintenant ? Écoutez votre instinct et essayez de ne pas vous laisser submerger par l'énorme quantité d'inspiration disponible. N'oubliez pas que c'est votre journée et votre budget et que vous devez faire ce qui vous convient, à vous et à votre partenaire, même si ce n'est pas traditionnel. N'ayez pas peur de demander de l'aide à vos amis !

https://www.goodrobe.fr/robe-de-mariee-e12

Nous avons eu beaucoup de chance de travailler avec nos amis talentueux et beaucoup ont participé au djing, à la restauration Robe de soirée dos nu, aux fleurs, aux invitations, etc. C'était vraiment un travail d'amour ! Si les invités viennent de l'étranger, essayez d'organiser un événement décontracté le lendemain du mariage afin de vous assurer de passer suffisamment de temps avec eux. La journée ira si vite et vous serez reconnaissant d'avoir un peu de temps supplémentaire à passer avec les gens qui ont fait un tel effort pour être là pour vous, même s'il ne s'agit que d'un pique-nique dans le parc.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21