Suggested problems

Sage Technical Error Support Phone | 1-866-646-3515 | Accountxpert

Jan. 23, 2019, 10:42 a.m. by Olivia Cruise

Biological Motivation

Sage 2019 Error Support: Now User can get instant help for Sage 19.0 Edition for Upgrade & update. Experts here who helps you to download Sage 19.0 Edition including Sage 50 Error Support, Sage Fixed Assets Support, Sage 100 help, Sage 300 Customer Support & Sage Payroll Software help either Its U.S. Version, UK Version or Canadian Version. From installation to setup, updates to upgrade, functional issue to critical error [Accountxpert][1] provides [Sage Error Technical Support][2] & help to their customer in various ways. Like User can directly submit their issue on their Knowledgebase or Form to get expert advice within the shortest time frame. User Can Also sends their queries to SAGE 50 Customer Service via submits issue form and get answers with some Error support link. The user can also request a Call back from SAGE 50 Error Customer Support just leaving their phone number, name and suitable time and associates will get in touch within one business day. Also, one powerful way to connect Via SAGE Error Toll-Free Number user just dial Toll-Free number 1-866-646-3515 and get the solutions or answer of their problem.

[1]: https://accountxpert.com/ [2]: https://accountxpert.com/sage-error-support/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21