Suggested problems

How to resolve Dell error code 0141

Jan. 23, 2019, 7:16 a.m. by hilaryduff

Biological Motivation

Dell error code 0141 is caused when there has been a mismatch between the hardware settings and the operating system of the computing device. It is an error which is detected when no hard drive has been detected by the system due to some errors in the system. You can fix this error code easily by implementing the steps given below:

 Shut down your laptop or computer completely  Press the Function key as per your laptop, and then hold the power button. Make sure that you do not remove your finger from the function key.  After the system will enter into a diagnostic mode.  Follow the onscreen instructions and allow the tool to run a diagnostic scan  Once the scanning process is completed, the error will be resolved.

If you find that the above procedure has not proved effective for you, then just directly contact the [Dell Customer Care][1] . They will be able to provide you with an alternate solution

Read More-: [800 number for dell support][2]

[1]: https://customer-care-help.com/dell-support/ [2]: https://customer-care-help.com/dell-support/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21