Suggested problems

How to change AT&T password on iPhone?

Oct. 29, 2018, 5:01 a.m. by james paul

Biological Motivation

...If you are an iPhone user and access your AT&T email via mobile mail app, you can easily change the password. Go through the [AT&T password reset][1] procedure explained over here. 1. Click on the email app of your iPhone. 2. Then go to the email settings option. 3. Click on change the password. 4. Then enter the current password. 5. Type new password & re-enter it for confirmation. 6. Now you will have to click on save and continue.

Visit here: [reset AT&T mail password][2]

[1]: https://www.email-passwordreset.com/at&t-password-reset.php [2]: https://www.email-passwordreset.com/at&t-password-reset.php

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21