Suggested problems

Netflix Com

Sept. 5, 2018, 4:58 a.m. by blakejones

Biological Motivation

We provide the best and facile assistance to those users, who find difficulty in [Netflix com][1] activate on TV. Well, don’t waste your time by roaming here and there, simply navigate to the door of professionals just by visiting Netflix Com. For more support..

[1]: https://www.technicalbulls.com/netflix-com-activate/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21