Suggested problems

Lucky Patcher apk Free Download

June 11, 2018, 8:52 a.m. by luckypatcherlatest

Biological Motivation

Lucky Patcher app is an Android app which comes in the working of hacking, everyone has Android mobile in today’s time, and most people like to play games to timepass and due to in-app purchases in the game Because people can not enjoy those games, friends because of the Lucky Patcher App [Download Lucky Patcher][1]

[1]: https://lluckypatcher.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21