Suggested problems

How to book flights tickets in online using google

June 7, 2018, 7:39 a.m. by googleflightss

Biological Motivation

Since a month i search for founding good deal for a multiple city air travel. Yesterday I found a good price on google flight. When i tried to book, it sadi i have to call the Air China compagnie so this it was I did. Unfortunatly the Air Line told me that they was unable to give me the same price on google. WHAT is the trap? What should I go and do? Please tel me any good info as soon as possible book using google flights on [google--flight][1]

[1]: https://www.google--flight.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21