Suggested problems

Manhattan distance of two DNA

April 13, 2018, 1:17 p.m. by Topu Dash Roy

Problem

Given two strings $s1$ and $s2$ of equal length, count the number of nucleotides occur in $s1$ and $s2$.

Given: Two DNA strings $s1$ and $s2$ of equal length at most 1000 nt.

Return: The Manhattan distance between strings.

Sample Dataset

GAGCCTACTAACGGGATCATCGTAATGACGGCCT
AGCTTTTCATTCTGACTGCAACGGGCAATATGTC

Sample Output

8