Suggested problems

Buy Modvigil Pills From A Reliable Online Pharmacy

April 8, 2021, 10:58 a.m. by Alicia Wikson

Biological Motivation

PharmaExpressRx is a reliable pharmacy that works round the clock for providing authentic medicines globally. People are attracted to this online pharmacy due to its best services like nowhere else. This online pharmacy is a top-seller of smart medicines such as modvigil. Also, you get 24/7 customer care service, which you can contact anytime if you have any queries. It is one of the best sources for buying medicines easily. https://www.pharmaexpressrx.com/purchase/modvigil.asp

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21