Suggested problems

The largest b2b portal of suppliers and manufacturers.

April 8, 2021, 9:59 a.m. by servicewale

Biological Motivation

Worldsindia B2B Marketplace Platform is an incredible SaaS stage to rapidly dispatch and work your own online Marketplace. Assemble your advanced biological system and speed up B2B portal with Worldsindia.

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21