Suggested problems

Explore tips for How to unblock people on Facebook:

April 7, 2021, 11:16 a.m. by Daisy38456

Biological Motivation

Many Facebook users block people when they get any unexpected messages on their social media account. However, they must know How to unblock people on Facebook. The requirement might appear for unblocking them. The initiatives in the right direction can assist Facebook users to manage their social media account efficiently. Several technical steps are there that have to be followed with attention to avoid the problems.

https://www.numbersforsupport.net/blog/unblock-someone-on-facebook/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21