Suggested problems

Rely On Pharmaexpressrx To Get Modvigil Reviews

April 6, 2021, 10:53 a.m. by Arthuro Oken

Biological Motivation

PharmaExpressRx is one of the top online pharmacies that offer high-quality medicines at the lowest price. The best part about this online pharmacy is that it offers medicines that are FDA approved such as modvigil to treat sleeping disorders. The specialty of this drugstore is that you get superior-quality medicines within the estimated time. It also offers 24/7 customer care service and discount deals. https://www.pharmaexpressrx.com/purchase/modvigil.asp

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21