Suggested problems

What's the Objective of a Cause-and-Effect Essay?

April 6, 2021, 9:27 a.m. by Sylvia99

Biological Motivation

The article is a form of qualitative composition that details the impact relationships between two topics. In standard cause-and-effect essay writing and academic papers, the writer shows how one person, thing, thought, or event directly influences another individual, object, idea, or event.

Meet One of Your New Trainers Pursue your fire with online classes taught by award-winning chefs, authors, and actors. Using 90+ hours of lessons, you won't ever quit learning.

What's the Objective of a Cause-and-Effect Essay? In a college environment, teachers https://collegehomeworktips.com/step-by-step-guidance-to-writing-an-excellent-creative-essay/ ">writing a good cause and effect essay to teach critical thinking, logic, and persuasive writing. In the sphere of academic writing or some specialist setting, this type of essay may choose the form of a laboratory report abstract, a scientific case analysis, or a scholarly research paper. In every one of these formats, a writer describes a phenomenon and attempts to identify its most important causes.

How to Compose a Cause-and-Effect Essay The cause-and-effect composing process requires critical thinking and an orderly cause-and-effect essay outline. Follow these six steps to write a cause-and-effect paper.

1.Begin by Brainstorming With a Venn Diagram Making up a good cause and effect topic involves observing the world and speculating about possible causes for everything you see. Consider natural happenings, social and cultural movements, or even the growth of ideas.

  1. Establish a Thesis. Your thesis statement can emphasize a single cause-and-effect connection, or in addition, it can reveal how one event causes multiple results. You may also research the way the phenomenon has several different causes.

  2. Organize Your Main Points Into Body Paragraphs. All your body paragraphs must provide a specific example of the thesis is authentic. Summarize your entire essay to make certain that every paragraph explores another facet of the connection between your topic and its triggers.

  3. Write a First Draft. Using your thesis statement and your body paragraph thoughts , craft the initial draft of your article . You ought to be creating a specific debate about just a single person, thing, idea, or event affects another one. Use clear subject sentences and transition words to maintain every body paragraph attached to your own thesis.

  4. Review Your Work for Clarity and Profession. Ask yourself these questions: Can I introduce a clear perspective? Do my examples show how one event caused the following? Are my adjustments and topic sentences clear and informative? Have I argued my point?

  5. Write a Last Draft. After giving your work a fair self-assessment, then re-draft your composition with an eye on a last item. In case you haven't previously written a decision, now's the time to do so. Keep in mind that a cause-and-effect essay depends on your critical thinking and the way it can express your logic into writing. If you have completed those things nicely, you most likely have a very convincing essay on your hands.

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21