Suggested problems

Order Waklert Online And Get Bonus Pills Free

April 5, 2021, 12:25 p.m. by Raquel

Biological Motivation

Waklert is a popular smart drug prescribed for the treatment of excessive sleepiness induced by narcolepsy. Waklert contains armodafinil that has been commonly used as a cognitive-boosting drug. If you are looking to buy Waklert online at a competitive price, ClickPharma is where you should pay a visit. It has been meeting people’s medical needs at the best prices. It has fulfilled thousands of prescriptions. ClickPharma is doling out bonus pills free on every purchase of Waklert online, along with free express shipping on bulk orders. https://www.clickpharma.com/nootropics-smart-drugs/waklert/ ...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21