Suggested problems

Safest Place On The Internet To Buy Filitra Online

April 2, 2021, 12:47 p.m. by Monica Manasia

Biological Motivation

If you have erectile dysfunction (ED) and want to buy Filitra online, ClickPharma is the safest place. It has fulfilled thousands of prescriptions, including Filitra. Authenticity, availability, and affordability are always ensured at ClickPharma. The online pharmacy acquires Filitra from its manufacturer in bulk; therefore, it is pretty cheap. Upon ordering Filitra online ( https://www.clickpharma.com/erectile-dysfunction-medications/filitra/ ) in bulk, you get 20 bonus pills free; this offer is exclusively available at ClickPharma. Also, consumers get free shipping on bulk purchases with special discounts. For more details, visit ClickPharma today.

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21