Suggested problems

Clickpharma Offers Tadacip 10mg Pills At Cheap Price

April 1, 2021, 11:06 a.m. by Surgie Morte

Biological Motivation

ClickPharma has been serving people with the best online pharmacy service, offering customers the best in healthcare. A dedicated team of professionals is committed to focusing on providing generic medicines at affordable prices. You will find a variety of generic drugs that are useful in treating various health issues, including Erectile Dysfunction (ED). Generic ED drugs, such as Tadacip, at this online pharmacy, are available at a very pocket-friendly price. Besides, on every order, you get a special discount and bonus pills free. Apart from that, ClickPharma doles out free shipping on bulk purchases. [https://www.clickpharma.com/erectile-dysfunction-medications/tadacip/][1] ...

[1]: https://www.clickpharma.com/erectile-dysfunction-medications/tadacip/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21