Suggested problems

How to get money off cash app without card.

April 1, 2021, 7:30 a.m. by James Thomas

Biological Motivation

Numerous cash app users are involved in seeking the steps that may enable them to find how to get money off cash app without card. Effective methods need to be applied to get the desired result. Therefore, they should learn the easy that may enable them to use the cash app properly with no issues. The possible technical issues however do not leave the technical payment account untouched.

https://www.email-contactsupport.com/blog/get-money-off-cash-app-without-card

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21