Suggested problems

Tips to transfer money from Apple pay to cash app.

April 1, 2021, 7:28 a.m. by James Thomas

Biological Motivation

The apple pay users are indulged in seeking the steps to send money from the Apple pay to cash app. The users should strive to take the help of the support team to get the perfect idea about the relevant strategies. They can quickly let them know the way through which they send money from apple pay to the cash app. With their guidance, they can follow the steps easily.

https://www.email-contactsupport.com/blog/transfer-money-from-apple-pay-to-cash-app

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21