Suggested problems

Assignment Writing Services

March 30, 2021, 11:12 a.m. by BartOlom

Biological Motivation

Don’t be worried about your academic paper because we have experienced for years that is the consequence, students boldly trust the provided benefits of assignment help 4 me offered by our professional writers. In this scenario, when you want professional help from our experts thus contact us and receive a well-known paper that meets your academic expectations towards us.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21