Suggested problems

Biological Motivation

https://american-meds.com/product-category/pain-relief/"> Buy pain-relief medicines at cheap price in USA online without prescriptions to treat all types of pain & get $25 OFF + $25 Cash Back, Fast + Free + Cash on Delivery & 100% safe medicines in USA @ American-meds.com

https://genericmedsupply.com/product-category/pain-relief/">Buy pain-relief medicines & get $25 OFF, Fast-Free-Cash on Delivery, Discount, 100% certified - FDA Approved drugs. Find details for Uses, Side Effects, Warnings, Precautions, Working Actions of the drugs like Pain O Soma, Ol-Tram, Aspadol (Tapentadol), Topdol & UDT (Tramadol) & so on @Genericmedsupply.

https://unitedmedicines.com/product-category/pain-relief/">Buy pain-relief medicines & get $25 OFF, Fast-Free-Cash on Delivery, Discount, 100% certified - FDA Approved drugs. Find details for Uses, Side Effects, Warnings, Precautions, Working Actions of the drugs like Pain O Soma, Ol-Tram, Aspadol (Tapentadol), Topdol & UDT (Tramadol) & so on @Unitedmedicines.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21