Suggested problems

Can I Trust Justfly?

March 30, 2021, 8 a.m. by James Williams

Biological Motivation

[Can I Trust Justfly][1] - Justfly was made by a group of mechanical specialists with a couple of long periods of involvement inside the movement business. We accept our foundation is top notch when it includes giving minimal effort tickets productively during an easy to use climate. we've cooperated with significant aircrafts to convey the lone costs conceivable to our clients. Our group of travel planners is prepared to help you on the telephone you'll have confidence we're with you each progression of the due to affirm your excursion is immaculate.

[1]: https://www.justcol.com/phone-number/justfly-customer-service-phone-number/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21