Suggested problems

Use Careprost For Eye Problem

March 26, 2021, 9:19 a.m. by Jaime_Corbett

Biological Motivation

Eye beauty is very necessary but small and light eyelids reduce beauty. A drop called careprost has been created only after women have thought about this problem. These drops should be continued only after consulting a doctor. With regular use of these drops, all women can get long, dark and thick eyelashes and enhance their beauty.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21