Suggested problems

Vilitra 60: A Medicine That Worked Wonders For ED

March 24, 2021, 8:23 a.m. by Jaime_Corbett

Biological Motivation

Vilitra 60 is the most powerful and effective erectile dysfunction drug and works for almost all men. This Vilitra medicine made from Vardenafil has fast action time so people prefer this medicine more. The basis of strength during intercourse is the same vilitra drug so it should be taken half an hour before intercourse activity.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21