Suggested problems

App Development Company Canada

March 24, 2021, 6:39 a.m. by Julia Johnson

Biological Motivation

iQlance, one of the best [app development companies in Canada][1], partners with revolutionary brands and disruptive start-ups to build digital products that please the users. Our app developers Canada have an exclusive approach to help brands and start-ups solve the great challenge of delivering outstanding user experiences, across every digital channel, to attain growth in a measurable way.

Our top app developers in Canada know the importance of creating mobile apps to build brands. Our app development Canada company has create a huge library of standard base plans and reusable codes that help you take lesser time to create the app and launch it to help attain faster ROI. Partnering with our app development company Canada offers you complete access to our experience that is derived by working with international customers belonging to different industry verticals.

Let’s come together to turn innovative ideas into highly successful apps.

[1]: https://www.iqlance.com/mobile-app-development/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21