Suggested problems

React Vs Angular: A Battle Between Two

March 24, 2021, 4:57 a.m. by surbhinahta

Biological Motivation

Hi,

Initially, both the React and Angular frameworks are used to develop web apps and modern enterprises are in rivalry to develop and deploy their web apps to drive a productive approach in their business while reserving their scalable part. Often businesses get confused when it comes to choosing React development or Angular development. So, let’s explain one by one and drive a difference between both.

Regards - AngularJS training in Pune

1: https://www.sevenmentor.com/angularjs-training-in-pune.php

Problem

Hi, Initially, both the React and Angular frameworks are used to develop web apps and modern enterprises are in rivalry to develop and deploy their web apps to drive a productive approach in their business while reserving their scalable part. Often businesses get confused when it comes to choosing React development or Angular development. So, let’s explain one by one and drive a difference between both.

Regards - AngularJS training in Pune

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21