Suggested problems

Vidalista 60: Buy Generic Medicine Online

March 17, 2021, 11:42 a.m. by Jaime_Corbett

Biological Motivation

Erectile dysfunction and male impotence occur during sexual intercourse, especially in adult men. Vidalista 60 medicine should be used if you want to get the best effect like strong erection during sexual time. If you want to buy Vidalista medicine at the lowest price, you should visit all the pharmacies available online.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21