Suggested problems

Modafinil & Armodafinil Tablets [$25 OFF] - Uses, Side Effects, Dosage

March 16, 2021, 1:15 p.m. by johnhood

Biological Motivation

Buy https://unitedmedicines.com/product-category/modafinil-armodafinil-adhd/">Modafinil Tablets / Armodafinil Tablets without prescriptions & get $25 OFF, Fast Free Cash on Delivery, $25 Discount & FDA Approved drugs. Find details for Uses, Side Effects, Warnings, Precautions, Warking Actions of the drugs like Modvigil, Waklert, Modalert, Modwake, Modvifil & Attentrol @Unitedmedicines.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

Buy [Modafinil Tablets / Armodafinil Tablets][1] without prescriptions & get $25 OFF, Fast Free Cash on Delivery, $25 Discount & FDA Approved drugs. Find details for Uses, Side Effects, Warnings, Precautions, Warking Actions of the drugs like Modvigil, Waklert, Modalert, Modwake, Modvifil & Attentrol @Unitedmedicines.

  [1]: https://unitedmedicines.com/product-category/modafinil-armodafinil-adhd/