Suggested problems

Connect to cash app customer service easily:

March 16, 2021, 10:50 a.m. by will smith

Biological Motivation

Every cash app account user strives to get to the easy techniques to connect to [cash app customer service][1] professionals. However, users may choose to connect to them through the calls and the email system. The problems with the online account are common issues but searching the accurate solution tips can only work. Service support professionals work to sort out the users of the cash app users concretely.

[1]: https://cash-app.contact-email-support.net/phone-number.html

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21